Chromosome 2 Fusion – What do subtelomeres look like?

As usual, we’ll start with a quote from Jeff Tomkins:

Second, the fusion-like sequence was very degenerate and only 70% similar to what one would expect of a pristine fusion sequence of the same size. Even if you assume an evolutionary timeline of up to six million years since the fusion event occurred, the data do not match up with known mutation rates or the variability found in human DNA.

Jeff Tomkins – More DNA Evidence Against Human Chromosome Fusion

The implicit assumption underlying this statement is that Jeff Tomkins believes that the sequences we find at the fusion site were – no more than six million years ago – pristine, perfect telomere repeats, and that they have since mutated into the “degenerate” arrays we see today. This assumption is utterly wrong-headed.

What he is ignoring is the fact that these “degenerate” arrays are found immediately adjacent to the telomeres in virtually all of the human chromosomes. What the chromosome 2 fusion sequence looks like to any reasonable, well-informed person is two chromosomes whose telomeres have been depleted to the point where these subtelomeric “degenerate” arrays are exposed, and the telomeres are no longer protecting the chromosomes from fusion.

First, here are some “degenerate” TTAGGG repeats, found at the “end” of some of our chromosomes:

>chromosome:GRCh38:4:190122446:190122745:1
ATGAGGGTTGGGGTTAGGGTTAGGGTTAGGGTGAGGGTGAGGGTGAGGGTGAGGGTGAGG
GTGAGGGTTAGGGTTAGGGGTTAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGGTAG
GGTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTGGGTTAGGGTTAGGGTCAGGG
TCAGGGTCAGGGTCAGGGTCAGGGTCAGGGTTAGGGGTTAGGGGTTAGGGTCAGGGTTAG
GGTTAGGGTTAGGGTTTTAGGGTTAGGGTTGGGGTTGGGGTTAGGGTTAGGGTTAGGGTT
>chromosome:GRCh38:1:248946010:248946309:1
GGGTTAGGGTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGGTTAGGGTTA
GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTGGGTTAGGGTTAGGGTTAGGGTTAG
GGTTAGGGGTTAGGGTTAGGGGTTAGGGTTGGGGTTGGGGTTGGGGTTGGGGTTGGGGTT
GGGGTTGGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTT
AGGGTGTTAGGGTGTTAGGGTGTTAGGGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
>chromosome:GRCh38:X:156030051:156030350:1
TGGGGTTAGGGTTAAGGGTTAGGGTTAGGGGTTAGGGGTTAGGGTTGGGGTTGGGGTTAG
GGTTAGGGTAGGGTTAGGGTTAGGGTTAGGGGTTAGGGGTTAGGGTAGGGTTAGGGTGAG
GGTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAG
GGGTTAGGGGTTAGGGTTAGGGTTAGGGGTTAGGGGTTAGGGTTAGGGTTAGGGGTTAGG
GTTAGGGTTAGGGGTTAGGGGTTAGGGGTTAGGGGTTAGGGTAGGGTAGGGTAGGGTAGG

Now here are some of the reverse motifs – CCCTAA – found at the “beginning” of our chromosomes:

>chromosome:GRCh38:1:10160:10459:1
CCCTAACCCTAACCCTAACCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC
CCTAACCCTAACCCCTAACCCTAACCCTAAACCCTAAACCCTAACCCTAACCCTAACCCT
AACCCTAACCCCAACCCCAACCCCAACCCCAACCCCAACCCCAACCCTAACCCCTAACCC
TAACCCTAACCCTACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCC
CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCTAACCCTAAC
>chromosome:GRCh38:9:10000:10299:1
NTAACCCTAACCCTAACCCTAACCCAACCCCACCCCAACCCCAACCCCAACCCAACCCTA
ACCCTAACCCTAACCCAACCCTAACCCTAACCCTAACCCAACCCTCACCCTCACCCTCAC
CCTCACCCTCACCCTCACCCTCACCCTAACCCTACCCTAACCCCTAACCCCTAACCCCTA
ACCCCTAACCCTTAACCCTAACCCTAACCCTACCCTAACCCTAACCCTAACCCCTAACCC
CTAACCCCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCCTAACCTCTAACCCT
>chromosome:GRCh38:18:10270:10569:1
TAACCCTAACCCTAACCCTACCCTAACCCTACCCTACCCTAACCCTAACCCTAACCCTAA
CCCTTAACCCTAACCCTAACCCTAACCCTACCCCAACCCCAACCCCAACCCCAACCCCAA
CCCCAACCCCAACCCCAACCCTACCCTAACCCTAACCCTAACCCTAAACCCCAACCCTAA
CCCCTAACCCCTACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTA
CCCTAACCCTACCCTACCCTAACCCTAACCCTAACCCTAACCCTTAACCCTAACCCTAAC

As you can see, these are not perfect telomeric repeats, and it is quite easy to visualise the resulting sequence if one of these “degenerate” forward arrays fused head-to-head with one of these “degenerate” reverse arrays.

It would look something like the picture that Jeff Tomkins himself has provided:

Tomkins-highlight
http://creation.com/chromosome-2-fusion-2

Funny that.

Advertisements

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s