Chromosome 2 Fusion – What should we expect?

Man, if I had a dollar for every time somebody told me that the fusion site doesn’t look like what we would expect it to look like, I’d have twenty-something million dollars. So, I thought I might download some DNA sequences for known mammalian fusions and show you what they look like.

Now the sequences I’m about to show you are from the Indian muntjac species, and if I may quote from a paper published in 2008:

Indian muntjac (Muntiacus muntjak vaginalis) has an extreme mammalian karyotype, with only six and seven chromosomes in the female and male, respectively. Chinese muntjac (Muntiacus reevesi) has a more typical mammalian karyotype, with 46 chromosomes in both sexes.

Comparative sequence analyses reveal sites of ancestral chromosomal fusions in the Indian muntjac genome

So clearly there have been a bunch of fusions in this Indian muntjac species and – luckily for us – they decided to sequence these fusion sites to see what they looked like. Now, remember these are not telomere-to-telomere fusions, these are telomere-to-satellite fusions, so they only correspond to one side of the human chromosome 2 fusion site.

“In chromosome fusion events that occur in nature in living mammals—a very rare event—the DNA signature always involves satDNA producing a DNA signature that occurs as either satDNA-satDNA or satDNA-teloDNA sequence.”

More DNA Evidence Against Human Chromosome Fusion

Behold!

This is what fusions actually look like.

http://www.ncbi.nlm.nih.gov/nuccore/DP000824

AGAGATCTAGTTTTCCACCAAAGATTTAAAATATCTCTCTGACCTCCTTTTTTTTGGGGAGGGGGGGGAG
GGTTTGAAGTTTTCATTTGCCCAAGGTTGAGGTCTCAGGCAAAGTAGGCAGTGTTTTCAAGGAAAGGGTT
CGGGTTCGGGTTCGGGTTCGGGTTCGGGTTCGGGTTAGGGTTCGGGTTAGGGTTAGGGTTCAGGTTAGGG
TTAGGGTTCGGGTTAGGGTTCGGGTTAGGGTTCGGGTTTAGGGTTAGGGTTCGGGTTAGGGTTAGGGGTT
AGGGTTAGGGATAGGGTTAGGGTTAGGGTTAGGGGTTAGGGTTCGGGTTAGGGTTAGGGTTCGGGTTAGG
TTTGGGGTTAGGGTTAGGGTTAGGGGTTAGGGTTAGGGTTAGGTTTAGGGTTTAGGGTTAGGGTTACGGT
TAGGGTTAGGGTTAGGGTTAGGGTTTAGGGTTAGTGTTAGGGTTAGGGTTAGGGTCAGGGTTAGGGTTTA
GGGTTAGGGTTAGGGTTAGGGTTAGGGTTTAGGGTTAGGGTTTAGGGTTAGGGTTAGGGTTAGGGTTAGG
GTTAGGGGTTAGGGTTAGGGTTAGGGTTAGGGATTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGT
GATAAGGCATTCTCTAGTGTCTCCCCAGGGGCTTCAGACTTCCCTTCATCTTGTGACACGTAATCCAGCT
TGTACTCAAGTCAGTGCAGGAATTCCGGCCTGATTTCCAGTCAGGGCATTTCAGGGTCGATTCCACTGGA

http://www.ncbi.nlm.nih.gov/nuccore/DP000825

TAGAATATCATGGCCATCAAACGTCGGGTCATCTTTCTTTCCTGATGGCATAGTTTTACCGCTGAATTAT
ACACAGATCAGCTGACAAGGTGATGTGAACCTGCGGAAGGAAGGATCACTAACGTGGTTCGGGAAAGGGG
TTTGGGTTCGGGTTCGGGTTCGGGTTCGGGTTCGGGTTCGGGTTAGGGTTCGGGTTAGGGTTAGGGTTAG
GGTTAGGGTTTGGGTTTGGGTTAGGGTTAGGGTTCGGGTTCGGGTTAGGGTTAGGGTTCGGGTTAGGGTT
CGGGTTAGGGTTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTCGGGTTCGGGTTCAGGTTAGGGTTAGG
GTTAGGGTTAGCGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGGTTAGTGTTAGGGTTAGGGTTAGGCT
TAGGGTTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTCAGGGTTTAGGGTTAGGGTTAGGGTTAGGGTTA
GGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGGTTAGGGTTAGGGTAAGGTTTAGGGTTAGGGGTTAGGGT
TAGGGTTAGCGTTAGGGTTAGGGTTAGGGTTAGGGGTTAGGGTAGGGTTCGGGTTAGGGTTAGGGTTAGG
GTTAGGTTTCGGGTTAGGGTTCGGCTTAGGGTTCGGGTTAGGGTTTAGGGTTAGGGTTTAGGGTTAGGGT
TAGGGTTAGGGTTCGGGTTCGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGCTCCTTTCAAGT
TTGATTGCGAGCACGGAATTGCTCTGCACGCAGTGCAGGGGAATCGGGCCTCATCTCATGGTGAGGGGGA
AGTCTCATGGTTTTTCTCGAGTTGCGGCCGGAACCTGGGATATATTCTCGAGTTACGACAGGGATGGCCC

http://www.ncbi.nlm.nih.gov/nuccore/DP000826

CTAGGTCAGGTCATCTTTCCTTTCTGTAGTCATAGTTAGACAGATCAGCTGATAAAAACCTTGGATTGTG
TCTGTGGGGTGGATTTGCTTGTCATTGTGCTTCAGCTGGCCAAGGTAGCAACGCCCGCGCCCCTCCCACG
GAAGTAGGAGTGGGGGCGGGGCGCACCGGGGGAGTGTCGGGCCGGGTTAGGGCTAGGGCTTAGGGCTTAG
GGCTTAGGGCTTAGGGCTTAGGGCTGAGGTTGGGGTTAAGGCTTAGGGTTAGGGCTGGGGTTGGGGTTAG
GGCTTAGGGCTTAGGGCTAGGGTTAGGGTTGGGCTTAGGGCTAGGGTTAGGGCTTAGGGCTTAGGGCTAG
GGCTTAGGGCTAGGGTTAGGGGTTAGGGTTAGGGTTAGGGTTAGAGGGTTAGGGTTAGGGTTAGGGTTAG
GGTTAGGGGTTAGGGTTAGGGTTAGGGTTAGGGTTACGGTTAGCGTTAGGGTTAGGGTTAGGGGTTAGGG
TTAGGGTTAGGGTTAGGGTTACGGTTAGCGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTTAGGGTTA
GGGTTAGGTTTAGGGTTAGGGTTTAGGGTTAGGGTTAGGGTTAGTGTTAGGGTTAGGGTCTGGATTGTCT
CCAGAGCCATCCCGCCTTCCCCATCAAACATGACAAGTGGCTTGACTTCCTTTAGACAGTTCCGAAGATT
CCTCGAGAATATCGTCGTCACAAGTCTAGAGGAACACCAAGTTCAGCACAGCAACTCGAGAAAAGCTCCG

http://www.ncbi.nlm.nih.gov/nuccore/DP000827

CTAGCTACCAGTCATTTAGAATAATTTACTGGATGCCGTCAACCACATTCTGTTTAGAGTGTACATATGC
AAATTGAATACAAGAAAAAAAAAACAACGAAACAGAACCCACTCATCTGGTTTTAAACCAAGATCATAAT
CACTATATCTTTCTCAATATATGAGATGTTAGTGAAAAATAATGTTAGGGTTAGGGGTTAGGGTTAGGGT
TAGGGTTGGGGTTGGGGTTAGGGTTAGGGTTAGGGTTAGGGTTCGGGGTTAGGGGTTAGGGTTAGGGGTT
AGGGTTAGGGTAGGGTTAGGGTTAGGGGTTAGGGTTAGGGGTTAGGGGTTAGGGGTTAGGGTTAGGGTTA
GGGGTAAGGGGTTAGGGTTAGGCGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTTGGGTTAGGGTTAG
GGTTAGGGTTACAGTTAGGGTTAGGGTTAGAGTCAGTTAGGGTTAGGGTTAGGGTTTAGGGTTAGGGTTA
GGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGCTTGATTCCCACGTGATTCCCTCCTGATTCC
CACGTGATTCCCACGTGATTCCCACGTGATTCCCACGTCACTCCCACGTGATTCCCACGTGATTCCCACG
TGACTGAGACGTGATTCCCACGTGATTCCCACGTGATTCCCACGCGATTTCCACATGATTCCCACGTGAT

http://www.ncbi.nlm.nih.gov/nuccore/DP000828

GCTGCATATAGGCCCAGAGTTCTGAGATGGTGGAATGAACCAACTGGACACTTAAAGAGACACTCCAAGT
GGATTAGAGAGACTGACTGCTCTAGGGATTGGGCTAGGGCTCGGGCTTGGGCTCGGGTTTGGGGTTCGGG
TTCGGGGTTCGGGTTCAGGCTCGGGCTCGGGTTTGGGGTTCGGGTTCGGGTTAGGGTTCGAGTTAGGGTT
CGGGTTCGGGTTCGGGTTAGGGTTCGGGTTCGGGTTCGGGTTCGGGTTAGGGTTAGGGTTCGGGTTCGGG
TTAGGGGTTAGGGTTAGGGTTAGGGCTAGGGTTAGGGTTAGGGTTAGGGTTAGGGGTTAGGGTTAGGGTT
AGGGTTAGGGGTTAGGGTTAGGGTTAGGGGTTAGGGTTAGGGGTTAGGGTTAGGGTTAGGGTTTAGGGTT
AGGGTTAGGGTTAAGGTTAGGGTTAGGGGTTAGGGTTAGGGTTCGGGTTCGGGTTCGGGTTAGGGTTAGG
GTTAGGGTTAGGGTTAGTGTTAGGGTTAGGGTTAGGTTTAGGGTTAGTGTTAGGGTTTAGGGTTAGGGTT
AGGGTTAGGGTTAGGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGCTTAGGGATTAGGGTTAGGGTTAG
GGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGGTTAGGGTTAGGGTTAGCGTTTAGGTTTAGGATTAGGT
TTAGGGTTAAGGTTAGGGTTAGGGTTTGGGTTAGGGTTAGCTCCCAGACGTACAGCTGCGAGAAGCCTCC
TCTTGTGGTGCTTGTGGACAGTTGGCATTCCTCTTGATTTGAAGCTAGGAAATCAGCCCTCACCTCGAGA
TGATTGGCGGAACACGGAGCTCTTTCTGCTTGCTGCAGTGACCTCAGTTTCCATCTTGACTTGAGACAGT

http://www.ncbi.nlm.nih.gov/nuccore/DP000829

CCGTGTAAACACACAGCCTTCCTAGGCCTTATGCCTCCTCGTCCATAAGGGGATGGTGGTTTTTCTGCTC
ATGGGGTGGGGGGAGGGCACACCTATGGCCACAGCACTGGCTCCATGGACAGCATGGTTCCTTGGGGGCC
TGGAGCCCCACAACTGATAAGACTGACACAAGAGCTGACATTAGGGTTCGGGTTCGGGTCAGGGTTCGGG
TCAGGGTTCGGGTCAGGGGTTAGGGTCAGGGTTAGGGTCAGGGGTTAGGGTCAGGGTTAGGGTTAGGGTT
AGGGGTTAGGGTCAGGGTCAGGGTCAGGGTCAGGGTCAGGGGTTAGGGTCAGGGTCAGGGTCAGGGTCAG
GGTCAGGGTTAGGGGTTAGGGTTAGGGTTATGGTTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGGTTAGG
GTTAGGGTTAGGGTTTAGGGTTAGGGGTTAGGGTTAGGGTTAGGGTTAGGGTTTAGGGTTAGGGTTTAGG
GTTAGGGTTAGGGTTAGGGTTTAGGGTTAGAGTTAAGGTTAGGGTTAGGGTTAGGGGTTAGGGTCAGGGT
CAGGGTCAGGGGTTAGGGTCAGGGTCAGGGTCAGGGTCAGGTTAGGGTTAGGGTTAGGGTTAGGGTTTAG
GGTTAGGGTTAGGGTTAGGGTTTAGGGTTAGGGTTTAGGGTTAGGATAAGGGTTAGGGTTTAGGGTTAGG
GTTAGGGTTAGGGTTTAGGGTTTAGGGTTTAGGGTTAGGGTTAGGGTTAGGTTTAGTGTTTAGGGTTAGG
GTTAGGGTTAGGTTTAGGTTAGGGTTAGGGTTAGGGTTTGGGTTAGGGTTAGGGTTAGGGTTAGGGGTTA
GGGTTAGGGTTAGGCTTTAGGGTTAGGGTTAGGGTTTAGGATTAGGGTTAGGGTTAGGGTTAGGGTTAGG
GTTAGGGTTTAGGGTTAGGGTTAGGGTTACGGTATAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTTAGGG
TTAGGTTTAGGGTTTGGGTTAGGGTTAGGGTTAGGGTGGAGGCCGCAAATTCAACCTCCCTCAACCAGAC
CTACAGCTGCGAGAAGCCTCCTCTTGTGGTGCTTGTGGACAGTTGGCATTCCTCTTGATTTGAAGCCAGG
AAATCAGCTCTCACCTCGAGATGATTCGGAATACACGGAGCTGTTTCTGGTTGGTGAAGTGACTTTAGGA

http://www.ncbi.nlm.nih.gov/nuccore/DP000830

CGTAGGAATGTGCCCATGAGATGAAAATATTGTCCTGAGTTGAAACGGAAGTTAAATTCAAAATCACGTT
GATGAGGCCAAGCAGCAGGAGTTGATTATGTGACTTCATCCTGAAGGGGCTCATCCGGGATCTTCTTTTC
CTTCTTCTTCCTGAGGATGATCTTAGTCTCTTGGGGGTCAGTGGAGTCCCTCTCTGCAGCCTGTTAGGGT
TAGTGTTAGGGTTAGGGTTAGGGTTTAGGGATAGAGTTAGGGTTAGGGTTAGGGTTAGGGTTAGTTAGGG
TTAGGGTTAGGGTTAGGATTAGGGTTTAGGGTAAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTT
AGGGTTAGGGTTAGGGTTAGTAATGGATGGGAGGCCGCCTGTCGAGAAAGGGCAGGGAGCTAGGGCTTTC
TCTAGTGTCTCCGCAGGGGCTTCAGACATCCCTTCATCTTGTGAGATGAAATCCAGCTTGCACTCAGGTC
ACTGCAGGAATTCCGGCCTGATTTCGTGTCAGGGCATCTCGGGATCGATTCCACTGGAGCTCGCAAATTC

In the Immortal Words of Dr Tomkins

First, the sequence was only about 800 bases long—not the 10,000 bases or more you would expect if two 5,000-base (or larger) telomeres fused together.

Second, the fusion-like sequence was very degenerate and only 70% similar to what one would expect of a pristine fusion sequence of the same size.

More DNA Evidence Against Human Chromosome Fusion

Who here agrees with him?

Advertisements

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s